اخبار اقتصادی

تغییر قیمت بدون تأیید سازمان حمایت تخلف است

محمدصادق مفتح در رابطه با افزایش قیمت تایر، روغن موتور، مواد شوینده و سایر کالاها در روزهای اخیر و میزان نظارت دولت در این‌باره، اظهار داشت:‌ سازمان حمایت بازوی کارشناسی ستاد تنظیم بازار است و شرکت‌های تولید‌کننده در صورت درخواست افزایش قیمت مستندات را به سازمان حمایت ارائه می‌دهند و سازمان حمایت نیز پس از بررسی و آنالیز قیمت‌ها آن را برای بررسی نهایی و تایید در اختیار ستاد تنظیم بازار قرار می‌دهد.

وی تأکید کرد: بنابراین سازمان حمایت جایگاه کارشناسی دارد و ستاد تنظیم بازار در نهایت تصمیم می‌گیرد که یک کالایی افزایش قیمت داشته باشد یا خیر.

قائم مقام وزیر صمت در امور بازرگانی در پاسخ به سوالی مبنی بر اینکه به عنوان قائم مقام وزیر صمت و وزارتخانه‌ای که نماینده‌ در ستاد تنظیم بازار دارد بفرمایید که آیا با افزایش قیمت‌ کالاهایی از قبیل تایر و روغن موتور توسط ستاد تنظیم بازار در روزهای اخیر موافقت شده است؟ گفت: هرگونه تغییر قیمتی در مورد کالاهای مختلف باید توسط سازمان حمایت از طریق اطلاعیه یا درج در سامانه ۱۲۴ اعلام شود، بنابراین تا زمانی که سازمان حمایت تغییرات قیمت‌ها را از طریق اطلاعیه اعلام نکرده و یا در سامانه ۱۲۴ ثبت و درج نکرده است به این معناست که فرآیند تصمیم‌گیری در مورد قیمت کالا‌هایی که تولیدکنندگان درخواست افزایش قیمت داده‌اند تکمیل نشده است.

مفتح با بیان اینکه قیمت‌گذاری هر کالایی فرآیند تصمیم‌گیری مخصوص به خود را دارد، اظهار داشت: به طور کلی قیمت تمام کالاها، فارغ از اینکه مربوط به کدام سازمان یا وزارتخانه هستند، از آنجا که سازمان حمایت یک سازمان فراوزارتخانه‌ای است، این سازمان باید تغییرات قیمت آنها را از روش‌هایی که ذکر شد اعلام کند.

قائم مقام وزیر صمت در امور بازرگانی اظهار داشت: بنابراین سازمان حمایت در مورد تغییرات قیمت چه اطلاعیه بدهد و چه اطلاعیه ندهد ملاک قیمت کالاها، قیمت‌های مندرج در سامانه ۱۲۴‌ سازمان حمایت است.

وی افزود: بنابراین اگر قیمت جدید کالایی در سامانه ۱۲۴ سازمان حمایت ثبت نشده باشد یعنی در مراجع تصمیم‌گیری قیمت تصویب نشده است.

وی بیان داشت: درباره تغییرات قیمت کالاها در بسیاری موارد ممکن است که سازمان حمایت اطلاعیه صادر نکند اما در سامانه قیمت‌های جدید را اعلام می‌کند و همکان ملاک واقعی است.

مفتح در پاسخ به این سوال که در رابطه با افزایش قیمت کالاهایی مانند تایر، مواد شوینده، روغن موتور و سایر کالاها که سازمان حمایت هیچ گونه‌ مصوبه‌ای در رابطه با افزایش قمیت این کالاها صادر نکرده است اما قیمت این کالاها در بازار افزایش یافته است، چه باید کرد؟ گفت: هرگونه افزایش قیمتی بدون اعلام اطلاعیه سازمان حمایت در مورد افزایش قیمت تخلف است.

وی در پاسخ به این سوال که شما از تخلف صحبت می‌کنید در حالی که در تمامی بازار این تغییرات قیمت اعمال شده و قیمت تایر خودروها و روغن موتور افزایش یافته است آیا با توجه به گستردگی این تخلفات امکان برخورد با آن وجود دارد؟ گفت: گستردگی تخلف موجب نمی‌شود که آن تخلف قانونی شود، اگر تخلفی حتی در حد گسترده انجام شود باید با آن برخورد شود.

وی در پاسخ به این سوال که در حالی که همه واحدهای صنفی عرضه تایر اتومبیل و روغن موتور و نیز شوینده، قیمت‌ها را گران کرده‌اند و امروز مردم در مقابل این تخلفات چه باید بکنند؟ گفت: پاسخ این سوال ۴۰ سال است که داده شده است، مردم می‌توانند با سامانه ۱۲۴ سازمان حمایت تماس بگیرند و گران فروشی را اعلام کنند تا اقدامات لازم درباره آن انجام شود و موضوع مورد رسیدگی قرار گیرد.

طبق اطلاعیه‌ای که تولید‌کنندگان تایر در فضای مجازی منتشر کردند قیمت تایرهای رادیال از روز ۸ خرداد به میزان ۳۰ درصد افزایش یافت و قیمت تایرهای بایاس نیز بین ۱۵ تا ۲۵ درصد افزایش یافت.

همچنین در روزهای اخیر خبری در فضای مجاز منتشر شد مبنی بر اینکه با موافقت سازمان حمایت مصرف‌کنندگان و تولیدکنندگان، قیمت محصولات روانکار موتوری (روغن موتور) به میزان ۲۵ درصد افزایش یافته است.

‌در روزهای اخیر افزایش قیمت مواد شوینده، تن ماهی، سس مایونز و حتی برخی از برندهای ‌‌تولید کننده بیسکویت و پفک نیز از طریق انجمن‌های مربوطه یا فضای مجازی اعلام شده است.

انتهای پیام/

‫۵۰ دیدگاه ها

  1. Therefore, decreased leptin is an essential mediator of beneficial outcomes associated with bariatric surgery and reduced adiposity 184, 202 is lasix a water pill To generate pcDNA5 FRT TO AQP2, AQP2 S256A, or AQP2 S256D myc constructs, AQP2 cDNAs were amplified by PCR and cloned into pcDNA5 FRT TO using the following primers forward 5 GGCCGAATAGGGCCCAAGCGGCCGCGACTCTAG 3 and reverse 5 GGCCGAATAGGATCC GAGCTCGGTACCAAGCTT 3

دیدگاهتان را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *

دکمه بازگشت به بالا